BrdU Incorporation Assay:Article Title: RTEL1 helicase counteracts RAD51-mediated homologous recombination and fork reversal to safeguard replicating genomes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RTEL1 Thermo Fisher Scientific Cat# PA5-71331; RRID: AB_2690764 Anti-BrdU (BrdU incorporation) BD Biosciences Cat# 555627 Rat anti-BrdU (For fiber) Abcam Cat# ab6326; RRID: AB_305426 Donkey Anti-Rat Alexa Fluor 594 (For fiber) Abcam Cat# ab150156; RRID: AB_2890252 Purified Mouse Anti-BrdU (For fiber) BD Biosciences Cat# 347580; RRID: AB_400326 Rabbit Anti-Mouse IgG H&L (Alexa Fluor 488) (For fiber) Abcam Cat# ab150125 Anti- pKAP1 S824 Abcam Cat# ab70369; RRID: AB_1209417 Anti- pCHK2 T68 Cell Signaling Technology Cat# 2197 Anti-Mouse IgG F(ab0)2 fragment–FITC Sigma-Aldrich Cat# F2883 Anti-FLAG tag Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti- H2AX (pS139) BD Biosciences Cat# 560443; RRID: AB_1645592 Anti-SMARCAL1 Abcam Cat# ab-154226 Anti-HLTF Santa Cruz Cat# sc-398357 Anti-ZRANB3 Abcam Cat# ab109595; RRID: AB_10866685 Anti-FBH1 Santa Cruz Cat# sc-81563 Anti-53BP1 Novus Cat# NB100-305B; RRID: AB_1659856 Anti- RAD51 Santa Cruz Cat# sc-8349; RRID: AB_2253533 Anti-Tubulin Santa Cruz Cat# sc-5286; RRID: AB_628411 Anti- MCM3 Santa Cruz Cat# sc-365616; RRID: AB_10846721 Anti-MCM2 Santa Cruz Cat# sc-373702 Anti-RPA70 Abcam Cat# ab79398; RRID: AB_1603759 Anti-HA tag Roche Cat# 10952100 Anti-RAD51C Santa Cruz Cat# sc-56214; RRID: AB_2238197 Anti-XRCC2 Santa Cruz Cat# sc-365854; RRID: AB_10846464 Anti-XRCC3 Santa Cruz Cat# sc-271714; RRID: AB_10708416 Anti-CDC45 Santa Cruz Cat# sc-55568; RRID: AB_831145 Anti-ORC2 Santa Cruz Cat# sc-398410 Anti-MUS81 Santa Cruz Cat# sc-47692; RRID: AB_2147129 Anti-SLX4 Santa Cruz Cat# sc-135225 Anti- pXRCC3 S225 Somyajit et al.44 N/A mouse anti-rabbit IgG-HRP Santa Cruz Cat# sc-2357 m-IgGk BP-HRP Santa Cruz Cat# sc-516102 (Continued on next page) Cell Reports 43, 114594, August 27, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-hRAD51 polyclonal antibody (ChIP analysis) Abcam Cat# ab-176458; RRID: AB_2665405 Anti-hRAD51C polyclonal antibody (ChIP analysis) Abcam Cat# ab-72063; RRID: AB_2177279 Chemicals, peptides, and recombinant proteins Hydroxyurea Sigma-Aldrich Cat# H8627 Zeocin Thermo Fisher Scientific Cat# R25001 5-Bromo-20-deoxyuridine Sigma-Aldrich Cat# B5002 Mirin Sigma-Aldrich Cat# M9948 DAPI Sigma-Aldrich Cat# D8417 5-Chloro-20-deoxyuridine Sigma-Aldrich Cat# C6891 5-Iodo-20-deoxyuridine Sigma-Aldrich Cat# I7125 cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat# 11836153001 PhosSTOP Roche Cat# 4906837001 Thiazolyl Blue Tetrazolium Bromide (MTT reagent) Sigma-Aldrich Cat# M2128 KaryoMAXTM ColcemidTM Solution Thermo Fisher Scientific Cat# 15212012 Agarose, low gelling temperature Sigma-Aldrich Cat# A9414 Protein-G Sepharose beads Cytiva Cat# GE17-0618-01 Propidium Iodide Sigma-Aldrich Cat# P4170 5-ethynyl-20-deoxyuridine Thermo Fisher Scientific A10044 Vectasheild Vector Labs Cat# H-1000 L-Ascorbic acid Sigma-Aldrich Cat# A92902 Alexa FluorTM 488 Azide Thermo Fisher Scientific Cat# A10266 Alexa FluorTM 647 Azide Thermo Fisher Scientific Cat# A10277 Deposited data Raw imaging and western data This paper http://www.doi.org/10.17632/ mrpw4tt7x9.1 Experimental models: Cell lines
Purification:Article Title: RTEL1 helicase counteracts RAD51-mediated homologous recombination and fork reversal to safeguard replicating genomes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RTEL1 Thermo Fisher Scientific Cat# PA5-71331; RRID: AB_2690764 Anti-BrdU (BrdU incorporation) BD Biosciences Cat# 555627 Rat anti-BrdU (For fiber) Abcam Cat# ab6326; RRID: AB_305426 Donkey Anti-Rat Alexa Fluor 594 (For fiber) Abcam Cat# ab150156; RRID: AB_2890252 Purified Mouse Anti-BrdU (For fiber) BD Biosciences Cat# 347580; RRID: AB_400326 Rabbit Anti-Mouse IgG H&L (Alexa Fluor 488) (For fiber) Abcam Cat# ab150125 Anti- pKAP1 S824 Abcam Cat# ab70369; RRID: AB_1209417 Anti- pCHK2 T68 Cell Signaling Technology Cat# 2197 Anti-Mouse IgG F(ab0)2 fragment–FITC Sigma-Aldrich Cat# F2883 Anti-FLAG tag Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti- H2AX (pS139) BD Biosciences Cat# 560443; RRID: AB_1645592 Anti-SMARCAL1 Abcam Cat# ab-154226 Anti-HLTF Santa Cruz Cat# sc-398357 Anti-ZRANB3 Abcam Cat# ab109595; RRID: AB_10866685 Anti-FBH1 Santa Cruz Cat# sc-81563 Anti-53BP1 Novus Cat# NB100-305B; RRID: AB_1659856 Anti- RAD51 Santa Cruz Cat# sc-8349; RRID: AB_2253533 Anti-Tubulin Santa Cruz Cat# sc-5286; RRID: AB_628411 Anti- MCM3 Santa Cruz Cat# sc-365616; RRID: AB_10846721 Anti-MCM2 Santa Cruz Cat# sc-373702 Anti-RPA70 Abcam Cat# ab79398; RRID: AB_1603759 Anti-HA tag Roche Cat# 10952100 Anti-RAD51C Santa Cruz Cat# sc-56214; RRID: AB_2238197 Anti-XRCC2 Santa Cruz Cat# sc-365854; RRID: AB_10846464 Anti-XRCC3 Santa Cruz Cat# sc-271714; RRID: AB_10708416 Anti-CDC45 Santa Cruz Cat# sc-55568; RRID: AB_831145 Anti-ORC2 Santa Cruz Cat# sc-398410 Anti-MUS81 Santa Cruz Cat# sc-47692; RRID: AB_2147129 Anti-SLX4 Santa Cruz Cat# sc-135225 Anti- pXRCC3 S225 Somyajit et al.44 N/A mouse anti-rabbit IgG-HRP Santa Cruz Cat# sc-2357 m-IgGk BP-HRP Santa Cruz Cat# sc-516102 (Continued on next page) Cell Reports 43, 114594, August 27, 2024 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-hRAD51 polyclonal antibody (ChIP analysis) Abcam Cat# ab-176458; RRID: AB_2665405 Anti-hRAD51C polyclonal antibody (ChIP analysis) Abcam Cat# ab-72063; RRID: AB_2177279 Chemicals, peptides, and recombinant proteins Hydroxyurea Sigma-Aldrich Cat# H8627 Zeocin Thermo Fisher Scientific Cat# R25001 5-Bromo-20-deoxyuridine Sigma-Aldrich Cat# B5002 Mirin Sigma-Aldrich Cat# M9948 DAPI Sigma-Aldrich Cat# D8417 5-Chloro-20-deoxyuridine Sigma-Aldrich Cat# C6891 5-Iodo-20-deoxyuridine Sigma-Aldrich Cat# I7125 cOmpleteTM, Mini Protease Inhibitor Cocktail Roche Cat# 11836153001 PhosSTOP Roche Cat# 4906837001 Thiazolyl Blue Tetrazolium Bromide (MTT reagent) Sigma-Aldrich Cat# M2128 KaryoMAXTM ColcemidTM Solution Thermo Fisher Scientific Cat# 15212012 Agarose, low gelling temperature Sigma-Aldrich Cat# A9414 Protein-G Sepharose beads Cytiva Cat# GE17-0618-01 Propidium Iodide Sigma-Aldrich Cat# P4170 5-ethynyl-20-deoxyuridine Thermo Fisher Scientific A10044 Vectasheild Vector Labs Cat# H-1000 L-Ascorbic acid Sigma-Aldrich Cat# A92902 Alexa FluorTM 488 Azide Thermo Fisher Scientific Cat# A10266 Alexa FluorTM 647 Azide Thermo Fisher Scientific Cat# A10277 Deposited data Raw imaging and western data This paper http://www.doi.org/10.17632/ mrpw4tt7x9.1 Experimental models: Cell lines
Virus:
Article Title: A mammalian model reveals inorganic polyphosphate channeling into the nucleolus and induction of a hyper-condensate state.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-tubulin Biolegend Cat# 625902; RRID: AB_493416 40,6-Diamidino-2-Phenylindole (DAPI) Sigma Cat# D9542 Alexa Fluor 488 Invitrogen Cat# A21202; RRID: AB_141607 Alexa Fluor 633 Invitrogen Cat# A21052; RRID: AB_2535719 Anti-Xpress Invitrogen Cat# R910-25; RRID: AB_2556552 DDX6 Invitrogen Cat# PA5-27786; RRID: AB_2545262 Fibrillarin Santa Cruz Biotechnology Cat# sc-374022; RRID: AB_10916877 JC-D7 MedKoo Cat# 585048 JC-D8 MedKoo Cat# 463766 Lamin A/C Santa Cruz Biotechnology Cat# sc-376248; RRID: AB_10991536 Myc Santa Cruz Biotechnology Cat# sc-40; RRID: AB_627268 NOP2 Invitrogen Cat# PA5-59073; RRID: AB_2644641 Nucleolin Santa Cruz Biotechnology Cat# sc-17826; RRID: AB_670270 Nucleophosmin Abcam Cat# ab10530; RRID: AB_297271 PAF49 Invitrogen Cat# MA5-27813; RRID: AB_2735299 Pericentrin Abcam Cat# ab4448; RRID: AB_304461 Secondary horseradish peroxidase-conjugated Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Secondary horseradish peroxidase-conjugated Sigma Cat# GENA934; RRID: AB_2722659 SYTOTM RNASelectTM Green Fluorescent cell Stain Thermo Fisher Scientific Cat# S32703 Bacterial and virus strains E. coli DH10B Invitrogen Cat# 18297010 Chemicals, peptides, and recombinant proteins 1,6-Hexanediol Sigma Cat# 240117 2% aqueous Osmium tetroxide solution TAAB Cat# O005 5003 Protease inhibitor cocktail Sigma Cat# P8340 AccuGel 19:1, (40% Acrylamide: Bis-Acrylamide 19:1) Geneflow Cat# A2-0060 Albumin Sigma Cat# A2153 BrUTP Sigma Cat# B7166 Doxycycline Hydrochloride Sigma Cat# D3072 Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# 21969035 Epon 812 resin Kit TAAB Cat# T043 Fetal Bovine Serum (FBS) Gibco Cat# 10500064 Fibronectin Sigma Cat# F1056 Formaldehyde 36% stock EM grade TAAB Cat# F003 GlutaMAXTM Gibco Cat# 35050087 Glut 25% stock vials TAAB Cat# G011 His-PPPX1 Lonetti et al. 201148 N/A IMM mounting medium Ibidi Cat# 50001 NuPAGE 4–12% bis-tris gels Invitrogen Cat# NP0321 P100 RegeneTiss Co. N/Aa poly-L-ornithine hydrobromide Sigma Cat# P3655 ProLongTM Diamond Antifade Mountant Invitrogen Cat# P36970 Propylene glycol Sigma Cat# W294004 (Continued on next page) e1 Cell Reports Methods 4, 100814, July 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membrane Bio-Rad Cat# 1620177 Recombinant polyP binding domain (PPBD) Saito et al., 200547 N/A S-(50-Adenosyl)-L-methionine iodide Sigma Cat# A4377 Sulforhodamine B Sigma Cat# S1402 Titanium dioxide beads Hichrom Cat# 5020-75000 Triton X-100 Sigma Cat# T8532 Critical commercial assays Clarity MaxTM Bio-Rad Cat# 1705062 DC Protein Assay Bio-Rad Cat# 5000116 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Deposited data Raw data This paper https://doi.org/10.17632/cwmfs4jwtk.1 Experimental models: Cell lines HeLa ATCC Cat# CRM-CCL-2; RRID: CVCL_0030 HTC116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human embryonic kidney (HEK) 293 ATCC Cat# CRL-1573; RRID: CVCL_0045 Human retinal pigment epithelial-1 (RPE1) ATCC Cat# CRL-4000; RRID: CVCL_4388 N2A ATCC Cat# CCL-131; RRID: CVCL_0470 T-RExTM-293 Cell Line Invitrogen Cat# R71007; RRID: CVCL_D585 Recombinant DNA and primers pCMV-Myc-N Clontech Cat# 635689 pGEM -T Easy Vector Systems Promega Cat# A1360 Primer OC440: ccg ctcgag a ATGGGTCA GGAAAAGCTATACATCG* N/a 50 XhoI-EcPPK (AP_003087) Primer OC441: ataagaat GCGGCCGC TTATT CAGGTTGTTCGAGTGATTTGATG* N/a 30 NotI-EcPPK (AP_003087) pTRE3G Clontech Cat# 631173 Software and algorithms Amira Thermo Scientific Version 2019 AZtec Oxford Instruments Version 2.1 Epson scan Epson Version 3.04A Fiji ImageJ N/A Photoshop Adobe Version CC 2019 Prism GraphPad Software Version 9 OPEN ACCESS
Recombinant:
Article Title: A mammalian model reveals inorganic polyphosphate channeling into the nucleolus and induction of a hyper-condensate state.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-tubulin Biolegend Cat# 625902; RRID: AB_493416 40,6-Diamidino-2-Phenylindole (DAPI) Sigma Cat# D9542 Alexa Fluor 488 Invitrogen Cat# A21202; RRID: AB_141607 Alexa Fluor 633 Invitrogen Cat# A21052; RRID: AB_2535719 Anti-Xpress Invitrogen Cat# R910-25; RRID: AB_2556552 DDX6 Invitrogen Cat# PA5-27786; RRID: AB_2545262 Fibrillarin Santa Cruz Biotechnology Cat# sc-374022; RRID: AB_10916877 JC-D7 MedKoo Cat# 585048 JC-D8 MedKoo Cat# 463766 Lamin A/C Santa Cruz Biotechnology Cat# sc-376248; RRID: AB_10991536 Myc Santa Cruz Biotechnology Cat# sc-40; RRID: AB_627268 NOP2 Invitrogen Cat# PA5-59073; RRID: AB_2644641 Nucleolin Santa Cruz Biotechnology Cat# sc-17826; RRID: AB_670270 Nucleophosmin Abcam Cat# ab10530; RRID: AB_297271 PAF49 Invitrogen Cat# MA5-27813; RRID: AB_2735299 Pericentrin Abcam Cat# ab4448; RRID: AB_304461 Secondary horseradish peroxidase-conjugated Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Secondary horseradish peroxidase-conjugated Sigma Cat# GENA934; RRID: AB_2722659 SYTOTM RNASelectTM Green Fluorescent cell Stain Thermo Fisher Scientific Cat# S32703 Bacterial and virus strains E. coli DH10B Invitrogen Cat# 18297010 Chemicals, peptides, and recombinant proteins 1,6-Hexanediol Sigma Cat# 240117 2% aqueous Osmium tetroxide solution TAAB Cat# O005 5003 Protease inhibitor cocktail Sigma Cat# P8340 AccuGel 19:1, (40% Acrylamide: Bis-Acrylamide 19:1) Geneflow Cat# A2-0060 Albumin Sigma Cat# A2153 BrUTP Sigma Cat# B7166 Doxycycline Hydrochloride Sigma Cat# D3072 Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# 21969035 Epon 812 resin Kit TAAB Cat# T043 Fetal Bovine Serum (FBS) Gibco Cat# 10500064 Fibronectin Sigma Cat# F1056 Formaldehyde 36% stock EM grade TAAB Cat# F003 GlutaMAXTM Gibco Cat# 35050087 Glut 25% stock vials TAAB Cat# G011 His-PPPX1 Lonetti et al. 201148 N/A IMM mounting medium Ibidi Cat# 50001 NuPAGE 4–12% bis-tris gels Invitrogen Cat# NP0321 P100 RegeneTiss Co. N/Aa poly-L-ornithine hydrobromide Sigma Cat# P3655 ProLongTM Diamond Antifade Mountant Invitrogen Cat# P36970 Propylene glycol Sigma Cat# W294004 (Continued on next page) e1 Cell Reports Methods 4, 100814, July 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membrane Bio-Rad Cat# 1620177 Recombinant polyP binding domain (PPBD) Saito et al., 200547 N/A S-(50-Adenosyl)-L-methionine iodide Sigma Cat# A4377 Sulforhodamine B Sigma Cat# S1402 Titanium dioxide beads Hichrom Cat# 5020-75000 Triton X-100 Sigma Cat# T8532 Critical commercial assays Clarity MaxTM Bio-Rad Cat# 1705062 DC Protein Assay Bio-Rad Cat# 5000116 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Deposited data Raw data This paper https://doi.org/10.17632/cwmfs4jwtk.1 Experimental models: Cell lines HeLa ATCC Cat# CRM-CCL-2; RRID: CVCL_0030 HTC116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human embryonic kidney (HEK) 293 ATCC Cat# CRL-1573; RRID: CVCL_0045 Human retinal pigment epithelial-1 (RPE1) ATCC Cat# CRL-4000; RRID: CVCL_4388 N2A ATCC Cat# CCL-131; RRID: CVCL_0470 T-RExTM-293 Cell Line Invitrogen Cat# R71007; RRID: CVCL_D585 Recombinant DNA and primers pCMV-Myc-N Clontech Cat# 635689 pGEM -T Easy Vector Systems Promega Cat# A1360 Primer OC440: ccg ctcgag a ATGGGTCA GGAAAAGCTATACATCG* N/a 50 XhoI-EcPPK (AP_003087) Primer OC441: ataagaat GCGGCCGC TTATT CAGGTTGTTCGAGTGATTTGATG* N/a 30 NotI-EcPPK (AP_003087) pTRE3G Clontech Cat# 631173 Software and algorithms Amira Thermo Scientific Version 2019 AZtec Oxford Instruments Version 2.1 Epson scan Epson Version 3.04A Fiji ImageJ N/A Photoshop Adobe Version CC 2019 Prism GraphPad Software Version 9 OPEN ACCESS
Protease Inhibitor:
Article Title: A mammalian model reveals inorganic polyphosphate channeling into the nucleolus and induction of a hyper-condensate state.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-tubulin Biolegend Cat# 625902; RRID: AB_493416 40,6-Diamidino-2-Phenylindole (DAPI) Sigma Cat# D9542 Alexa Fluor 488 Invitrogen Cat# A21202; RRID: AB_141607 Alexa Fluor 633 Invitrogen Cat# A21052; RRID: AB_2535719 Anti-Xpress Invitrogen Cat# R910-25; RRID: AB_2556552 DDX6 Invitrogen Cat# PA5-27786; RRID: AB_2545262 Fibrillarin Santa Cruz Biotechnology Cat# sc-374022; RRID: AB_10916877 JC-D7 MedKoo Cat# 585048 JC-D8 MedKoo Cat# 463766 Lamin A/C Santa Cruz Biotechnology Cat# sc-376248; RRID: AB_10991536 Myc Santa Cruz Biotechnology Cat# sc-40; RRID: AB_627268 NOP2 Invitrogen Cat# PA5-59073; RRID: AB_2644641 Nucleolin Santa Cruz Biotechnology Cat# sc-17826; RRID: AB_670270 Nucleophosmin Abcam Cat# ab10530; RRID: AB_297271 PAF49 Invitrogen Cat# MA5-27813; RRID: AB_2735299 Pericentrin Abcam Cat# ab4448; RRID: AB_304461 Secondary horseradish peroxidase-conjugated Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Secondary horseradish peroxidase-conjugated Sigma Cat# GENA934; RRID: AB_2722659 SYTOTM RNASelectTM Green Fluorescent cell Stain Thermo Fisher Scientific Cat# S32703 Bacterial and virus strains E. coli DH10B Invitrogen Cat# 18297010 Chemicals, peptides, and recombinant proteins 1,6-Hexanediol Sigma Cat# 240117 2% aqueous Osmium tetroxide solution TAAB Cat# O005 5003 Protease inhibitor cocktail Sigma Cat# P8340 AccuGel 19:1, (40% Acrylamide: Bis-Acrylamide 19:1) Geneflow Cat# A2-0060 Albumin Sigma Cat# A2153 BrUTP Sigma Cat# B7166 Doxycycline Hydrochloride Sigma Cat# D3072 Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# 21969035 Epon 812 resin Kit TAAB Cat# T043 Fetal Bovine Serum (FBS) Gibco Cat# 10500064 Fibronectin Sigma Cat# F1056 Formaldehyde 36% stock EM grade TAAB Cat# F003 GlutaMAXTM Gibco Cat# 35050087 Glut 25% stock vials TAAB Cat# G011 His-PPPX1 Lonetti et al. 201148 N/A IMM mounting medium Ibidi Cat# 50001 NuPAGE 4–12% bis-tris gels Invitrogen Cat# NP0321 P100 RegeneTiss Co. N/Aa poly-L-ornithine hydrobromide Sigma Cat# P3655 ProLongTM Diamond Antifade Mountant Invitrogen Cat# P36970 Propylene glycol Sigma Cat# W294004 (Continued on next page) e1 Cell Reports Methods 4, 100814, July 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membrane Bio-Rad Cat# 1620177 Recombinant polyP binding domain (PPBD) Saito et al., 200547 N/A S-(50-Adenosyl)-L-methionine iodide Sigma Cat# A4377 Sulforhodamine B Sigma Cat# S1402 Titanium dioxide beads Hichrom Cat# 5020-75000 Triton X-100 Sigma Cat# T8532 Critical commercial assays Clarity MaxTM Bio-Rad Cat# 1705062 DC Protein Assay Bio-Rad Cat# 5000116 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Deposited data Raw data This paper https://doi.org/10.17632/cwmfs4jwtk.1 Experimental models: Cell lines HeLa ATCC Cat# CRM-CCL-2; RRID: CVCL_0030 HTC116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human embryonic kidney (HEK) 293 ATCC Cat# CRL-1573; RRID: CVCL_0045 Human retinal pigment epithelial-1 (RPE1) ATCC Cat# CRL-4000; RRID: CVCL_4388 N2A ATCC Cat# CCL-131; RRID: CVCL_0470 T-RExTM-293 Cell Line Invitrogen Cat# R71007; RRID: CVCL_D585 Recombinant DNA and primers pCMV-Myc-N Clontech Cat# 635689 pGEM -T Easy Vector Systems Promega Cat# A1360 Primer OC440: ccg ctcgag a ATGGGTCA GGAAAAGCTATACATCG* N/a 50 XhoI-EcPPK (AP_003087) Primer OC441: ataagaat GCGGCCGC TTATT CAGGTTGTTCGAGTGATTTGATG* N/a 30 NotI-EcPPK (AP_003087) pTRE3G Clontech Cat# 631173 Software and algorithms Amira Thermo Scientific Version 2019 AZtec Oxford Instruments Version 2.1 Epson scan Epson Version 3.04A Fiji ImageJ N/A Photoshop Adobe Version CC 2019 Prism GraphPad Software Version 9 OPEN ACCESS
Immunoprecipitation:
other:Article Title: Natural killer cell dysfunction drives keloid pathogenesis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Human CD3 Biolegend Cat# 317306; RRID: AB_571907 Anti-Human CD4 Biolegend Cat# 317408; RRID: AB_571951 Anti-Human TCRα/β Biolegend Cat# 306706; RRID: AB_314644 Anti-Human TCRγ/δ Biolegend Cat# 331208; RRID: AB_1575108 Anti-Human CD19 Biolegend Cat# 302206; RRID: AB_314236 Anti-Human CD20 Biolegend Cat# 302304; RRID: AB_314252 Anti-Human CD22 Biolegend Cat# 363508; RRID: AB_2564614 Anti-Human CD14 Biolegend Cat# 325604; RRID: AB_830677 Anti-Human CD34 ebioscience Cat# 11-0349-42; RRID: AB_1518732 Anti-Human FcεR1α ebioscience Cat# 11-5899-42; RRID: AB_10732835 Anti-Human CD1a Biolegend Cat# 300104; RRID: AB_314018 Anti-Human CD11c Biolegend Cat# 301604; RRID: AB_314174 Anti-Human CD123 Biolegend Cat# 306014; RRID: AB_2124259 Anti-Human CD303 Biolegend Cat# 354208; RRID: AB_2561364 Anti-Human TBX21 ebioscience Cat# 25-5825-82; RRID; AB_11042699 Anti-Human IFN-γ ebioscience Cat# 17-7319-82; RRID: AB_469506 Anti-Human IFN-γ ebioscience Cat# 45-7319-42; RRID: AB_10718246 Anti-Human TNF-α ebioscience Cat# 45-7349-42; RRID; AB_10718247 Anti-Human AREG ebioscience Cat# 17-5370-42; RRID: AB_2716941 Anti-Human AREG ebioscience Cat# 12-5370-42; RRID: AB_2716926 Anti-Human CD45 ebioscience Cat# 56-9459-42; RRID: AB_2574511 Anti-Human ISG15 R&D Cat# IC8044P; RRID: AB_3656663 Anti-Human LAP Biolegend Cat# 364403; RRID: AB_2910407 Anti-Human CD90 Biolegend Cat# 328117; RRID: AB_961312 Anti-Human TIGIT Biolegend Cat# 372703; RRID: AB_2632729 Anti-Human Ki67 Biolegend Cat# 350533; RRID: AB_2566228 Anti-Human CD127 BD Cat# 562436; RRID: AB_11151911 Anti-Human CD56 BD Cat# 564057; RRID: AB_2738568 Anti-Human p-AKT1 (S473) Invitrogen Cat# 17-9715-41; RRID: AB_2573309 Anti-Human p-ERK1/2 (T202, Y204) BD Cat# 562981; RRID: AB_2737930 Anti-Human p-STAT1 (Y701) Invitrogen Cat# 12-9008-42; RRID: AB_2572669 Anti-Human NKG2A Biolegend Cat# 375111; RRID: AB_2888864 Anti-Human Annexin V Biolegend Cat# 640932 Anti-Collagen I Invitrogen Cat# PA5-95137; RRID: AB_2806942 Anti-Collagen III Invitrogen Cat# PA5-27828; RRID: AB_2545304 Anti-a-SMA Abcam Cat# ab124964; RRID: AB_11129103 Anti-CD90 Servicebio Cat# GB113753 Anti-p-SHP-1 (Y564) Cell Signaling Technology Cat# 8849T Anti-GAPDH Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 Goat anti-Rabbit IgG Invitrogen Cat# 31460; RRID: AB_228341 Goat anti-Mouse IgG HUABIO Cat# HA1006; RRID: AB_2819167 Goat anti-Rabbit IgG Invitrogen Cat# A32732; RRID: AB_2633281 Donkey anti-Rabbit IgG Invitrogen Cat# A21206; RRID: AB_2535792 (Continued on next page) Cell Reports 45, 117129, April 28, 2026 17
Control:
Western Blot:
Staining:Article Title: A mammalian model reveals inorganic polyphosphate channeling into the nucleolus and induction of a hyper-condensate state.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-tubulin Biolegend Cat# 625902; RRID: AB_493416 40,6-Diamidino-2-Phenylindole (DAPI) Sigma Cat# D9542 Alexa Fluor 488 Invitrogen Cat# A21202; RRID: AB_141607 Alexa Fluor 633 Invitrogen Cat# A21052; RRID: AB_2535719 Anti-Xpress Invitrogen Cat# R910-25; RRID: AB_2556552 DDX6 Invitrogen Cat# PA5-27786; RRID: AB_2545262 Fibrillarin Santa Cruz Biotechnology Cat# sc-374022; RRID: AB_10916877 JC-D7 MedKoo Cat# 585048 JC-D8 MedKoo Cat# 463766 Lamin A/C Santa Cruz Biotechnology Cat# sc-376248; RRID: AB_10991536 Myc Santa Cruz Biotechnology Cat# sc-40; RRID: AB_627268 NOP2 Invitrogen Cat# PA5-59073; RRID: AB_2644641 Nucleolin Santa Cruz Biotechnology Cat# sc-17826; RRID: AB_670270 Nucleophosmin Abcam Cat# ab10530; RRID: AB_297271 PAF49 Invitrogen Cat# MA5-27813; RRID: AB_2735299 Pericentrin Abcam Cat# ab4448; RRID: AB_304461 Secondary horseradish peroxidase-conjugated Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Secondary horseradish peroxidase-conjugated Sigma Cat# GENA934; RRID: AB_2722659 SYTOTM RNASelectTM Green Fluorescent cell Stain Thermo Fisher Scientific Cat# S32703 Bacterial and virus strains E. coli DH10B Invitrogen Cat# 18297010 Chemicals, peptides, and recombinant proteins 1,6-Hexanediol Sigma Cat# 240117 2% aqueous Osmium tetroxide solution TAAB Cat# O005 5003 Protease inhibitor cocktail Sigma Cat# P8340 AccuGel 19:1, (40% Acrylamide: Bis-Acrylamide 19:1) Geneflow Cat# A2-0060 Albumin Sigma Cat# A2153 BrUTP Sigma Cat# B7166 Doxycycline Hydrochloride Sigma Cat# D3072 Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# 21969035 Epon 812 resin Kit TAAB Cat# T043 Fetal Bovine Serum (FBS) Gibco Cat# 10500064 Fibronectin Sigma Cat# F1056 Formaldehyde 36% stock EM grade TAAB Cat# F003 GlutaMAXTM Gibco Cat# 35050087 Glut 25% stock vials TAAB Cat# G011 His-PPPX1 Lonetti et al. 201148 N/A IMM mounting medium Ibidi Cat# 50001 NuPAGE 4–12% bis-tris gels Invitrogen Cat# NP0321 P100 RegeneTiss Co. N/Aa poly-L-ornithine hydrobromide Sigma Cat# P3655 ProLongTM Diamond Antifade Mountant Invitrogen Cat# P36970 Propylene glycol Sigma Cat# W294004 (Continued on next page) e1 Cell Reports Methods 4, 100814, July 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membrane Bio-Rad Cat# 1620177 Recombinant polyP binding domain (PPBD) Saito et al., 200547 N/A S-(50-Adenosyl)-L-methionine iodide Sigma Cat# A4377 Sulforhodamine B Sigma Cat# S1402 Titanium dioxide beads Hichrom Cat# 5020-75000 Triton X-100 Sigma Cat# T8532 Critical commercial assays Clarity MaxTM Bio-Rad Cat# 1705062 DC Protein Assay Bio-Rad Cat# 5000116 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Deposited data Raw data This paper https://doi.org/10.17632/cwmfs4jwtk.1 Experimental models: Cell lines HeLa ATCC Cat# CRM-CCL-2; RRID: CVCL_0030 HTC116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human embryonic kidney (HEK) 293 ATCC Cat# CRL-1573; RRID: CVCL_0045 Human retinal pigment epithelial-1 (RPE1) ATCC Cat# CRL-4000; RRID: CVCL_4388 N2A ATCC Cat# CCL-131; RRID: CVCL_0470 T-RExTM-293 Cell Line Invitrogen Cat# R71007; RRID: CVCL_D585 Recombinant DNA and primers pCMV-Myc-N Clontech Cat# 635689 pGEM -T Easy Vector Systems Promega Cat# A1360 Primer OC440: ccg ctcgag a ATGGGTCA GGAAAAGCTATACATCG* N/a 50 XhoI-EcPPK (AP_003087) Primer OC441: ataagaat GCGGCCGC TTATT CAGGTTGTTCGAGTGATTTGATG* N/a 30 NotI-EcPPK (AP_003087) pTRE3G Clontech Cat# 631173 Software and algorithms Amira Thermo Scientific Version 2019 AZtec Oxford Instruments Version 2.1 Epson scan Epson Version 3.04A Fiji ImageJ N/A Photoshop Adobe Version CC 2019 Prism GraphPad Software Version 9 OPEN ACCESS
Modification:Article Title: A mammalian model reveals inorganic polyphosphate channeling into the nucleolus and induction of a hyper-condensate state.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-tubulin Biolegend Cat# 625902; RRID: AB_493416 40,6-Diamidino-2-Phenylindole (DAPI) Sigma Cat# D9542 Alexa Fluor 488 Invitrogen Cat# A21202; RRID: AB_141607 Alexa Fluor 633 Invitrogen Cat# A21052; RRID: AB_2535719 Anti-Xpress Invitrogen Cat# R910-25; RRID: AB_2556552 DDX6 Invitrogen Cat# PA5-27786; RRID: AB_2545262 Fibrillarin Santa Cruz Biotechnology Cat# sc-374022; RRID: AB_10916877 JC-D7 MedKoo Cat# 585048 JC-D8 MedKoo Cat# 463766 Lamin A/C Santa Cruz Biotechnology Cat# sc-376248; RRID: AB_10991536 Myc Santa Cruz Biotechnology Cat# sc-40; RRID: AB_627268 NOP2 Invitrogen Cat# PA5-59073; RRID: AB_2644641 Nucleolin Santa Cruz Biotechnology Cat# sc-17826; RRID: AB_670270 Nucleophosmin Abcam Cat# ab10530; RRID: AB_297271 PAF49 Invitrogen Cat# MA5-27813; RRID: AB_2735299 Pericentrin Abcam Cat# ab4448; RRID: AB_304461 Secondary horseradish peroxidase-conjugated Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Secondary horseradish peroxidase-conjugated Sigma Cat# GENA934; RRID: AB_2722659 SYTOTM RNASelectTM Green Fluorescent cell Stain Thermo Fisher Scientific Cat# S32703 Bacterial and virus strains E. coli DH10B Invitrogen Cat# 18297010 Chemicals, peptides, and recombinant proteins 1,6-Hexanediol Sigma Cat# 240117 2% aqueous Osmium tetroxide solution TAAB Cat# O005 5003 Protease inhibitor cocktail Sigma Cat# P8340 AccuGel 19:1, (40% Acrylamide: Bis-Acrylamide 19:1) Geneflow Cat# A2-0060 Albumin Sigma Cat# A2153 BrUTP Sigma Cat# B7166 Doxycycline Hydrochloride Sigma Cat# D3072 Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# 21969035 Epon 812 resin Kit TAAB Cat# T043 Fetal Bovine Serum (FBS) Gibco Cat# 10500064 Fibronectin Sigma Cat# F1056 Formaldehyde 36% stock EM grade TAAB Cat# F003 GlutaMAXTM Gibco Cat# 35050087 Glut 25% stock vials TAAB Cat# G011 His-PPPX1 Lonetti et al. 201148 N/A IMM mounting medium Ibidi Cat# 50001 NuPAGE 4–12% bis-tris gels Invitrogen Cat# NP0321 P100 RegeneTiss Co. N/Aa poly-L-ornithine hydrobromide Sigma Cat# P3655 ProLongTM Diamond Antifade Mountant Invitrogen Cat# P36970 Propylene glycol Sigma Cat# W294004 (Continued on next page) e1 Cell Reports Methods 4, 100814, July 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PVDF membrane Bio-Rad Cat# 1620177 Recombinant polyP binding domain (PPBD) Saito et al., 200547 N/A S-(50-Adenosyl)-L-methionine iodide Sigma Cat# A4377 Sulforhodamine B Sigma Cat# S1402 Titanium dioxide beads Hichrom Cat# 5020-75000 Triton X-100 Sigma Cat# T8532 Critical commercial assays Clarity MaxTM Bio-Rad Cat# 1705062 DC Protein Assay Bio-Rad Cat# 5000116 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Deposited data Raw data This paper https://doi.org/10.17632/cwmfs4jwtk.1 Experimental models: Cell lines HeLa ATCC Cat# CRM-CCL-2; RRID: CVCL_0030 HTC116 ATCC Cat# CCL-247; RRID: CVCL_0291 Human embryonic kidney (HEK) 293 ATCC Cat# CRL-1573; RRID: CVCL_0045 Human retinal pigment epithelial-1 (RPE1) ATCC Cat# CRL-4000; RRID: CVCL_4388 N2A ATCC Cat# CCL-131; RRID: CVCL_0470 T-RExTM-293 Cell Line Invitrogen Cat# R71007; RRID: CVCL_D585 Recombinant DNA and primers pCMV-Myc-N Clontech Cat# 635689 pGEM -T Easy Vector Systems Promega Cat# A1360 Primer OC440: ccg ctcgag a ATGGGTCA GGAAAAGCTATACATCG* N/a 50 XhoI-EcPPK (AP_003087) Primer OC441: ataagaat GCGGCCGC TTATT CAGGTTGTTCGAGTGATTTGATG* N/a 30 NotI-EcPPK (AP_003087) pTRE3G Clontech Cat# 631173 Software and algorithms Amira Thermo Scientific Version 2019 AZtec Oxford Instruments Version 2.1 Epson scan Epson Version 3.04A Fiji ImageJ N/A Photoshop Adobe Version CC 2019 Prism GraphPad Software Version 9 OPEN ACCESS
Isolation:
cDNA Synthesis:
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 